Please take some time to answer this and try to be honest! :
1. Do you ever think about death?
2. How does it make you feel?
3. Have you lost any beloved ones? How did it make you feel?
4. How did you cope?
5. What do you think life is?
6. What is the opposite of life?
7. Do you believe in life after death?
8. Are you a religious person? If yes please identify your religion and how you got involved in it.
9. When you die how do you want people to remember you by?
10. Do you think life can be preserved?
11. Describe different ways in which people replace social activities when alone. (it can be an object, an activity, a procedure e.t.c.)
Thank you!
Hello everyone, Just to get you started, this is not a blog about the outfits that I daily choose to wear filled with pictures of myself looking inside the camera lence as I have no soul. It is not a blog of wasting my free time and informing you all what my next lunch will be consisted by. This is a blog of my 3rd year final project in design. Which means loads of ideas, theories, sketches, prototypes and RESEARCH! So if it's not ur piece of cake please wwwurselves and thanks for the visit.
8 Feb 2011
2 Feb 2011
Photosynthetic photographs on grass
Artist duo Heather Ackroyd and Dan Harvey, explored recording images through the production of chlorophyll.
Our inquiry into how to "fix" these transient images has brought us close involvement with genetics through research with scientists at IGER (Institute of Grassland and Environmental Research) in Wales. These scientists have developed a grass that keeps its green color even under stress. In a naturally occurring variant of grass, they identified a gene for an enzyme that degrades the green pigment chlorophyll, and by modulating the expression of this gene, they were able to alter the grassÃs aging behavior and even stop it altogether. Through a plant breeding program they have introduced this trait, coined a stay-green, into a rye grass. The application of this grass in our work has subsequently led us to grow photographic canvases and then dry them. While the green blades retain their chlorophyll much more effectively than regular grass, the effects of other processes, such as oxidative bleaching, gradually occur and over time contribute to an irreversible loss of image.
Sunbathers, 2000
http://www.viewingspace.com/genetics_culture/pages_genetics_culture/gc_w02/gc_w02_ackroyd_harvey.htm
Our inquiry into how to "fix" these transient images has brought us close involvement with genetics through research with scientists at IGER (Institute of Grassland and Environmental Research) in Wales. These scientists have developed a grass that keeps its green color even under stress. In a naturally occurring variant of grass, they identified a gene for an enzyme that degrades the green pigment chlorophyll, and by modulating the expression of this gene, they were able to alter the grassÃs aging behavior and even stop it altogether. Through a plant breeding program they have introduced this trait, coined a stay-green, into a rye grass. The application of this grass in our work has subsequently led us to grow photographic canvases and then dry them. While the green blades retain their chlorophyll much more effectively than regular grass, the effects of other processes, such as oxidative bleaching, gradually occur and over time contribute to an irreversible loss of image.
Sunbathers, 2000
http://www.viewingspace.com/genetics_culture/pages_genetics_culture/gc_w02/gc_w02_ackroyd_harvey.htm
Alexander Tsiaras
Alexander Tsiaras is the founder of Anatomical Travelogue http://www.anatomicaltravel.com/ .
With his work he tries to make people live a better life. 3D photography of human anatomy, detailed up to cell level.
"We want to change how people think about health, think about their bodies. The way to do that is by telling stories--beautiful, compelling, visual stories that show what an amazing thing the body is."
Tsiaras's minions turn CT, MRI, and electron microscope scans of the body--flat black-and-white images--into living, moving, colorful 3-D flesh. Working from pure computer data, the zeros and ones produced by the scanning devices, they are far removed from conventional medical illustrators, who start with a bare canvas or screen.http://health.usnews.com/usnews/health/articles/060320/20maverick.htm
Mum with Baby
Conception
Encoding digital information
Eduardo Kac is an artist that produces bio-art. I think he is really inspiring when mixing natural forms of life with technology. Do not know whether (for me that is) working with plants or animals is "easier" but it might be a good start.
Here are some examples of his work :
"Move 36" makes reference to the dramatic move made by the computer called Deep Blue against chess world champion Gary Kasparov in 1997. This competition may be characterized as a match between the greatest chess player who ever lived and the greatest chess player who never lived. The installation sheds light on the limits of the human mind and the increasing capabilities developed by computers and robots, inanimate beings whose actions often acquire a force comparable to subjective human agency.
According to Kasparov, Deep Blue's quintessential moment in game two came at Move 36. Rather than making a move expected by viewers and commentators alike--a sound move that would have afforded immediate gratification--it made a move that was subtle and conceptual and, in the long run, better. Kasparov could not believe that a machine had made such a keen move. The game, in his mind, was lost.
The installation presents a chessboard made of earth (dark squares) and white sand (light squares) in the middle of the room. There are no chess pieces on the board. Positioned exactly where Deep Blue made its Move 36 is a plant whose genome incorporates a new gene that I created specifically for this work. The gene uses ASCII (the universal computer code for representing binary numbers as Roman characters, on- and off-line) to translate Descartes's statement: "Cogito ergo sum" (I think therefore I am) into the four bases of genetics.
Eduardo Kac, "Move 36", 2004 (detail).
Through genetic modification, the leaves of the plants curl. In the wild these leaves would be flat. The "Cartesian gene" was coupled with a gene that causes this sculptural mutation in the plant, so that the public can see with the naked eye that the "Cartesian gene" is expressed precisely where the curls develop and twist.
The "Cartesian gene" was produced according to a new code I created especially for the work. In 8-bit ASCII, the letter C, for example, is: 01000011. Thus, the gene is created by the following associations between genetic bases and binary digits:
A = 00
C = 01
G = 10
T = 11
The result is the following gene with fifty-two bases:
CAATCATTCACTCAGCCCCACATTCACCCCAGCACTCATTCCATCCCCCATC
The creation of this gene is a critical and ironic gesture, since Descartes considered the human mind a "ghost in the machine" (for him the body was a "machine"). His rationalist philosophy gave new impetus both to the mind-body split (Cartesian dualism) and to the mathematical foundations of current computer technology.
source :
http://www.ekac.org/move36.html
Here are some examples of his work :
"Move 36" makes reference to the dramatic move made by the computer called Deep Blue against chess world champion Gary Kasparov in 1997. This competition may be characterized as a match between the greatest chess player who ever lived and the greatest chess player who never lived. The installation sheds light on the limits of the human mind and the increasing capabilities developed by computers and robots, inanimate beings whose actions often acquire a force comparable to subjective human agency.
According to Kasparov, Deep Blue's quintessential moment in game two came at Move 36. Rather than making a move expected by viewers and commentators alike--a sound move that would have afforded immediate gratification--it made a move that was subtle and conceptual and, in the long run, better. Kasparov could not believe that a machine had made such a keen move. The game, in his mind, was lost.
The installation presents a chessboard made of earth (dark squares) and white sand (light squares) in the middle of the room. There are no chess pieces on the board. Positioned exactly where Deep Blue made its Move 36 is a plant whose genome incorporates a new gene that I created specifically for this work. The gene uses ASCII (the universal computer code for representing binary numbers as Roman characters, on- and off-line) to translate Descartes's statement: "Cogito ergo sum" (I think therefore I am) into the four bases of genetics.
Eduardo Kac, "Move 36", 2004 (detail).
Through genetic modification, the leaves of the plants curl. In the wild these leaves would be flat. The "Cartesian gene" was coupled with a gene that causes this sculptural mutation in the plant, so that the public can see with the naked eye that the "Cartesian gene" is expressed precisely where the curls develop and twist.
The "Cartesian gene" was produced according to a new code I created especially for the work. In 8-bit ASCII, the letter C, for example, is: 01000011. Thus, the gene is created by the following associations between genetic bases and binary digits:
A = 00
C = 01
G = 10
T = 11
The result is the following gene with fifty-two bases:
CAATCATTCACTCAGCCCCACATTCACCCCAGCACTCATTCCATCCCCCATC
The creation of this gene is a critical and ironic gesture, since Descartes considered the human mind a "ghost in the machine" (for him the body was a "machine"). His rationalist philosophy gave new impetus both to the mind-body split (Cartesian dualism) and to the mathematical foundations of current computer technology.
source :
http://www.ekac.org/move36.html
1 Feb 2011
Interesting
This is a video in which designer James King presents his projects and the way he likes to think. I think I am into this sort of mentality, now at least. It is very interesting and it is worth watching it.
Speculative Design?
James King and Alexandra Daisy Ginsberg are two designers that have worked on several projects about new technologies and how will these have an affect on society.
In their design proposal with the collaboration of iGem Team from Cambridge University they showed an idea about how synthetic biology can collaborate with design.they designed the E.chromi which was a new variety of E.coli that can secrete many different colours to the naked eye. The showed seven different proposals about what this would be in 100 years for services laws and prodects inspired by E.chromi.
http://www.echromi.com/
This is a video where the two designers explain their work
Jam09 05 - E.chromi interview with Daisy Ginsberg and James King from mac cowell on Vimeo.
In their design proposal with the collaboration of iGem Team from Cambridge University they showed an idea about how synthetic biology can collaborate with design.they designed the E.chromi which was a new variety of E.coli that can secrete many different colours to the naked eye. The showed seven different proposals about what this would be in 100 years for services laws and prodects inspired by E.chromi.
http://www.echromi.com/
This is a video where the two designers explain their work
Jam09 05 - E.chromi interview with Daisy Ginsberg and James King from mac cowell on Vimeo.
Art and bio-science
There are many artists that have worked in different forms and with different medium, in order to explore either the effect that bioscience will eventually have on people or experimented with biological sciences.
My first example is the Anthrax Clock by Hunter O'Reilly.
In this, we see four photos of the artist superimposed on a clock. In each of the frames the anthrax cells and spores multiply under her face, and as the anthrax cells are increased there is a change from a happy face expression to a traumatised.
The next artist is Al Wunderlich and his Living Paintings.
They are created in order to be visible under a microscope. He used bacteria that was genetically engineered with fluorescent proteins. They are placed on acrylic plates in temperature controlled rooms and the bacteria when the resin is removed are basically animated.
My first example is the Anthrax Clock by Hunter O'Reilly.
In this, we see four photos of the artist superimposed on a clock. In each of the frames the anthrax cells and spores multiply under her face, and as the anthrax cells are increased there is a change from a happy face expression to a traumatised.
The next artist is Al Wunderlich and his Living Paintings.
They are created in order to be visible under a microscope. He used bacteria that was genetically engineered with fluorescent proteins. They are placed on acrylic plates in temperature controlled rooms and the bacteria when the resin is removed are basically animated.
Bioscience?
After writing my dissertation I finally focused on a specific theme for my final project. As I was doing my research on death and existence, I came across bio-science. I discovered interesting facts about the vitality of cells when are detached from the human body and if they are possible to survive after one has passed away. Many theories sometimes even contradicting each other, suggest that either through a certain context (environment if you prefer) body cells can still keep living. Another theory was that what we call healthy cells are not able to exist but the cancerous ones are what we can simply claim immortal. Of course the vitality of cells can only be considered as existence according to time (first factor/parameter) and through division. Have still not enough theory or research to actually acclaim that there is more to it, something that is in my next plans.
Anthropologists now are questioned to give a proper answer to what life and death is because of the advance in sciences.
As this is my area of focus now, the next step of course is to question what happens then after all? Of course there is no life as we originally think (a human being functioning as everyone does) but there is still a part of us, even in the tiniest form of a cell, that can still be left behind when we die. The question which is opposed then, almost by itself, is how people will then react? When someone that we love does pass away, but there is still a part of him/her that is vivid, does something then change in the way we see death? If so the bigger question is, how does society accept that. Are death rituals changed?Or even discarded. Do we still grieve and mourn for the person that we just lost?
It might be very sci-fi to create something that will either comfort us at the event of death or simply to acclaim immortality but is it possible? What if there were actually a device, gadget, site, data or even a form of being that can have a little bit of us (if not us as an entity) that can be alive after what in the medical world we call death?
Anthropologists now are questioned to give a proper answer to what life and death is because of the advance in sciences.
As this is my area of focus now, the next step of course is to question what happens then after all? Of course there is no life as we originally think (a human being functioning as everyone does) but there is still a part of us, even in the tiniest form of a cell, that can still be left behind when we die. The question which is opposed then, almost by itself, is how people will then react? When someone that we love does pass away, but there is still a part of him/her that is vivid, does something then change in the way we see death? If so the bigger question is, how does society accept that. Are death rituals changed?Or even discarded. Do we still grieve and mourn for the person that we just lost?
It might be very sci-fi to create something that will either comfort us at the event of death or simply to acclaim immortality but is it possible? What if there were actually a device, gadget, site, data or even a form of being that can have a little bit of us (if not us as an entity) that can be alive after what in the medical world we call death?
17 Jan 2011
Declaring Existence
Ways you know you exist (as I have thought of) in the digital world :
This is an example of what I mean declaring your existence (touching the screen and you see results). Maybe a way with instant results.
- interactive games
- sims game
- touch screens
- digital data
- social network profiles and views (the fascination of everyday mundane documentation)
- comments from other people on your profile
This is an example of what I mean declaring your existence (touching the screen and you see results). Maybe a way with instant results.
Subscribe to:
Posts (Atom)







